Lathrapanteles Williams 1985

Primary tabs

EOL Text

Statistics of barcoding coverage:

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:63
Specimens with Sequences:53
Specimens with Barcodes:38
Species:8
Species With Barcodes:8
Public Records:32
Public Species:5
Public BINs:5

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=92667

Statistics of barcoding coverage: Lathrapanteles Janzen02:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=398173

Barcode data: Lathrapanteles Whitfield01:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATTTTATATTTTATATTTGGAATATGGTCTGGTATATTAGGATTTTCTTTGAGTTTTATTATTCGTTTGGAATTAGGTATACCAGGGAGTTTAATTGGTAATGATCAAATTTATAATAGAATTGTAACTTCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGTTTTGGTAATTGATTGATTCCTTTAATGTTAGGAGCTCCAGATATATCATTTCCTCGAATAAATAATATAAGGTTTTGGTTATTAATTCCTTCATTATTTTTATTGATTATAAGTAGATTTATTAATGTTGGAGTAGGTACAGGTTGAACAGTTTATCCTCCATTATCTTTAATTTTAGGTCATGGAGGTTTTTCAGTTGATATAGGAATTTTTTCTTTGCATTTAGCTGGTGCTTCTTCAATTATGGGTGCTGTTAATTTTATTACTACAATTATTAATATACGTACAAATAAATTTAATATAGATAAAATATCTTTATTTGTTTGATCAGTTTTTATTACTGCTATTTTATTATTATTATCATTACCTGTTTTGGCTGGTGCTATTACTATATTATTAACTGATCGTAATATAAATACAAGTTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTN
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=96491

Statistics of barcoding coverage: Lathrapanteles Whitfield01:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=96491

Barcode data: Lathrapanteles Whitfield02:

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATATTATATTTTATATTTGGTTTATGATCAGGTATATTAGGTTTTTCAATAAGTTTAATTATTCGATTAGAATTAGGAATACCTGGAAGATTAATTGGTAATGATCAAATTTATAATAGAATTGTTACTTCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAGTTATAATTGGTGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGTTCACCAGATATATCATTTCCTCGTATAAATAATATAAGTTTTTGATTATTAATTCCTTCATTATTTATATTAATTATAAGTGGTTTTATTAATGTTGGTGTTGGAACAGGTTGAACAGTTTATCCTCCTTTATCATTAATTTTAGGTCATGGTGGTATATCAGTTGATTTAGGTATTTTTTCTTTACATTTAGCGGGTGCTTCATCAATTATAGGTGCAGTTAATTTTATTACAACAATTATAAATATACGAAGAAATCTATTTAAAATAGATAAAATATCTTTATTTTCTTGATCTGTATTTATTACAGCTATTTTATTATTATTATCTTTACCAGTTTTAGCTGGTGCTATTACTATATTATTAACTGATCGTAATTTAAATACAAGATTTTTTGATCCTTCAGGTGGTGGTGATCCAATTCTTTATCAACATTTATTT
-- end --


Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=96474

Statistics of barcoding coverage: Lathrapanteles Whitfield02:

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=96474

Barcode data:

Access Published & Released Data: Download FASTA File

Licensehttp://creativecommons.org/licenses/by/3.0/
Rights holder/AuthorSujeevan Ratnasingham, Paul D.N. Hebert, Barcode of Life Data Systems (BOLD)
Sourcehttp://www.boldsystems.org/index.php/Taxbrowser_Taxonpage?taxid=92667
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith